Sequence ID | >C171085898 |
Genome ID | CP018874 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Priestia megaterium JX285 [CP018874] |
Start position on genome | 2235246 |
End posion on genome | 2235317 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aaataaatgt |
tRNA gene sequence |
GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGTCGCGAGTTCGAACC |
Downstream region at tRNA end position |
tttcaaaagc |
Secondary structure (Cloverleaf model) | >C171085898 Gly GCC t Ttct tttcaaaagc G - C C - G G - C G - C A - T A - T G - C C A T T G C T C A G A A + | | | | G T C T T G G C G A G C G | | | | T T G G A A C T A A GGGTC C - G C - G A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |