| Sequence ID | >C171092963 |
| Genome ID | CP019404 |
| Phylum/Class | Gammaproteobacteria |
| Species | Salmonella enterica subsp. enterica serovar Bardo SA20113257 [CP019404] |
| Start position on genome | 4714923 |
| End posion on genome | 4715007 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
cctcttcagt |
| tRNA gene sequence |
GCCGAAGTGGCGAAATCGGTAGACGCAGTTGATTCAAAATCAACCGTAGAAATACGTGCC |
| Downstream region at tRNA end position |
tcggaacatc |
| Secondary structure (Cloverleaf model) | >C171092963 Leu CAA
t ACCA tcggaacatc
G - C
C - G
C - G
G - C
A - T
A - T
G - C T G
T C G G C C A
T A A G | | | | | G
C A G C G G C C G G C
G | | | T T
G A C G C
T A G A CGTAGAAATACGT
G - C
T - A
T - A
G - C
A - T
T A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |