| Sequence ID | >C171097824 |
| Genome ID | CP019668 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia cenocepacia VC7848 [CP019668] |
| Start position on genome | 3624829 |
| End posion on genome | 3624905 |
| Amino Acid | Arg |
| Anticodon | ACG |
| Upstream region at tRNA start position |
cgttttgcgt |
| tRNA gene sequence |
GCGGCTGTAGCTCAGTTGGATAGAGTACTTGGCTACGAACCAAGGGGTCGTGGGTTCGAA |
| Downstream region at tRNA end position |
ccttaaaagg |
| Secondary structure (Cloverleaf model) | >C171097824 Arg ACG
t GCCA ccttaaaagg
G - C
C - G
G - C
G - C
C - G
T - A
G - C T A
T C G T C C A
T G A A | + + | | G
T C T C G G T G G G C
G | | | + T T
G G A G T
A T A A GGGTC
C - G
T - A
T - A
G - C
G - C
C A
T A
A C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |