| Sequence ID | >C171097847 |
| Genome ID | CP019668 |
| Phylum/Class | Betaproteobacteria |
| Species | Burkholderia cenocepacia VC7848 [CP019668] |
| Start position on genome | 7092998 |
| End posion on genome | 7092914 |
| Amino Acid | Leu |
| Anticodon | GAG |
| Upstream region at tRNA start position |
cccttgcagt |
| tRNA gene sequence |
GCCGACGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCTGTGCG |
| Downstream region at tRNA end position |
gatgcgtttt |
| Secondary structure (Cloverleaf model) | >C171097847 Leu GAG
t ACCA gatgcgtttt
G - C
C - G
C - G
G - C
A - T
C - G
G - C T G
T C G C T C A
T A A G | | | | | G
T A G T G G C G A G C
G | | | T T
G A C A C
T A G G TGGCGAAAGCTGT
C - G
T - A
A - T
T + G
C - G
T G
T G
G A G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |