Sequence ID | >C171102804 |
Genome ID | CP020019 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Staphylococcus aureus 08S00974 [CP020019] |
Start position on genome | 2233751 |
End posion on genome | 2233677 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ttaatattaa |
tRNA gene sequence |
TCCACAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGTC |
Downstream region at tRNA end position |
tggctccttg |
Secondary structure (Cloverleaf model) | >C171102804 Asn GTT a GCCA tggctccttg T - A C - G C - G A - T C - G A - T G - C T G T C A T C C A G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A T CGGTC A - T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |