| Sequence ID | >C171102990 |
| Genome ID | CP020030 |
| Phylum/Class | Bacillota |
| Species | Geobacillus thermodenitrificans T12 [CP020030] |
| Start position on genome | 157454 |
| End posion on genome | 157525 |
| Amino Acid | Gly |
| Anticodon | GCC |
| Upstream region at tRNA start position |
tcatcatgat |
| tRNA gene sequence |
GCGGAAGTAGTTCAGTGGTAGAACACCACCTTGCCAAGGTGGGGGTCGCGGGTTCGAGTC |
| Downstream region at tRNA end position |
aacggggcct |
| Secondary structure (Cloverleaf model) | >C171102990 Gly GCC
t Tttg aacggggcct
G - C
C - G
G - C
G - C
A - T
A - T
G - C T G
T T G C C C A
G A A + | | | | G
T C T T G G C G G G C
G | | | | T T
G G A A C
T A A GGGTC
C - G
C - G
A - T
C - G
C - G
T A
T A
G C C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |