| Sequence ID | >C171103156 |
| Genome ID | CP020039 |
| Phylum/Class | Actinomycetota |
| Species | Streptomyces sp. 3211 [CP020039] |
| Start position on genome | 5395623 |
| End posion on genome | 5395697 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
ggtttaccga |
| tRNA gene sequence |
CGCGGGGTGGAGCAGCTCGGTAGCTCGCTGGGCTCATAACCCAGAGGTCGCAGGTTCAAA |
| Downstream region at tRNA end position |
aagactcagg |
| Secondary structure (Cloverleaf model) | >C171103156 Met CAT
a ACtg aagactcagg
C T
G - C
C - G
G - C
G - C
G - C
G - C T A
T T G T C C A
C G A G + | | | | A
T C G A G G C A G G C
C | | | | T T
G G C T C
G T A G AGGTC
C - G
T - A
G - C
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |