| Sequence ID | >C171105133 |
| Genome ID | CP020347 |
| Phylum/Class | Gammaproteobacteria |
| Species | Pasteurella multocida subsp. septica CIRMBP-0873 [CP020347] |
| Start position on genome | 374866 |
| End posion on genome | 374791 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
tgtttttttt |
| tRNA gene sequence |
GGACAGTTAACTCAGTTGGTAGAGTGGCTGGCTGTTAACCAGTATGTCGCAGGTTCAAAT |
| Downstream region at tRNA end position |
aattcacaag |
| Secondary structure (Cloverleaf model) | >C171105133 Asn GTT
t GCCA aattcacaag
G - C
G - C
A - T
C - G
A - T
G - C
T - A T A
T C G C C C A
T G A A | | | | A
T C T C A G C A G G C
G | | | | T T
G G A G T
T A G ATGTC
G + T
C - G
T - A
G - C
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |