| Sequence ID | >C171108863 |
| Genome ID | CP020538 |
| Phylum/Class | Alphaproteobacteria |
| Species | Sphingobium herbicidovorans MH [CP020538] |
| Start position on genome | 1915149 |
| End posion on genome | 1915225 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
aacaaacaac |
| tRNA gene sequence |
GGGCCGGTAGCTCAGGTGGTTAGAGCGCACGCCTGATAAGCGTGAGGTCGGAGGTTCAAC |
| Downstream region at tRNA end position |
tttggtttgg |
| Secondary structure (Cloverleaf model) | >C171108863 Ile GAT
c ACCA tttggtttgg
G - C
G - C
G - C
C - G
C - G
G - C
G - C T C
T C C T C C A
G G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A G AGGTC
C - G
A - T
C - G
G - C
C - G
C A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |