| Sequence ID | >C171120144 |
| Genome ID | CP021505 |
| Phylum/Class | Bacillota |
| Species | Bacillus amyloliquefaciens SRCM101267 [CP021505] |
| Start position on genome | 2989972 |
| End posion on genome | 2989886 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
taccatccat |
| tRNA gene sequence |
GCCGGGGTGGTGGAATTGGCAGACACACAGGACTTAAAATCCTGCGGTAGGTGACTACCG |
| Downstream region at tRNA end position |
attgctgcgc |
| Secondary structure (Cloverleaf model) | >C171120144 Leu TAA
t ACtt attgctgcgc
G - C
C - G
C - G
G - C
G + T
G - C
G - C T G
T C G G C C A
T A A G | | | | | A
T G G T G G C C G G C
G | | | T T
G A C A C
C A G A CGGTAGGTGACTACCGT
C - G
A - T
G - C
G - C
A - T
C A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | - |
| Comment | |
| --- | |
| Input Comment |