Sequence ID | >C171122743 |
Genome ID | CP021751 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Klebsiella pneumoniae AR_0113 [CP021751] |
Start position on genome | 1231927 |
End posion on genome | 1232001 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tttcatttcg |
tRNA gene sequence |
GGGTCAGAAGCACAGCGGTTGTGCGTTCGGCTGTTAACCGAATGGTCGAAGGTTCGAATC |
Downstream region at tRNA end position |
gataatggcc |
Secondary structure (Cloverleaf model) | >C171122743 Asn GTT g GCCA gataatggcc G - C G - C G - C T T C - G A - T G - C T A A C T T C C A G A A | | | | | G C C A C G G A A G G C G | | | | T T G G T G C T T G TGGTC T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |