Sequence ID | >C171122964 |
Genome ID | CP021768 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Stenotrophomonas sp. WZN-1 [CP021768] |
Start position on genome | 1025239 |
End posion on genome | 1025147 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gcagggatcc |
tRNA gene sequence |
GGAGAGGTGTCCGAGTGGTTGAAGGAGCACGCCTGGAAAGTGTGTAAGCGTCTAAACCGC |
Downstream region at tRNA end position |
gacaaatgaa |
Secondary structure (Cloverleaf model) | >C171122964 Ser GGA c GCCA gacaaatgaa G - C G - C A - T G - C A - T G - C G + T T A T C C C C C A T G A G | | | | | G G G C C T G G G G G C G | | | T T T A G G A T G A G TAAGCGTCTAAACCGCGCTTC C - G A - T C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |