Sequence ID | >C171123323 |
Genome ID | CP021793 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sinorhizobium meliloti USDA1157 [CP021793] |
Start position on genome | 381042 |
End posion on genome | 381118 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cttgccgagt |
tRNA gene sequence |
GCGGTTGTAGCTCAGTTGGTTAGAGCGCAGGTTTGTGGCACCTGAGGTCGGAGGTTCGAT |
Downstream region at tRNA end position |
ttttcttcaa |
Secondary structure (Cloverleaf model) | >C171123323 His GTG t ACCA ttttcttcaa G + T C - G G - C G - C T - A T - A G - C C T T C C C C C A T G A A | | | | G T C T C G G G A G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C G - C T - A T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | - |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |