Sequence ID | >CHL090102810 |
Genome ID | EF115542 |
Search identical group | |
Phylum/Class | Viridiplantae |
Species | Sorghum bicolor |
Start position on genome | 54788 |
End posion on genome | 54862 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gtgataaatT |
tRNA gene sequence |
GCCTACTTAACTCAGTGGTTAGAGTATTGCTTTCATACGGCGGGAGTCATTGGTTCAAAT |
Downstream region at tRNA end position |
aggtagaaaa |
Secondary structure (Cloverleaf model) | >CHL090102810 Met CAT T AGgt aggtagaaaa G + T C - G C - G T - A A - T C - G T - A T A T T A A C C A T G A A | | | | | A G C T C A A T T G G C G | | | | T T T G A G T T A A GAGTC T + G T + G G - C C - G T + G T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |