Sequence ID | >PHG0100103 |
Genome ID | AJ604531 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Salmonella phage 5 K-12 (AJ604531) |
Start position on genome | 7850 |
End posion on genome | 7774 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccaaatttaa |
tRNA gene sequence |
GTCCTGTTAGACAAACTGGTAAAGTCACTACCCTTTCAAGGTAGGATTTGCGGGTTCGAT |
Downstream region at tRNA end position |
atttctgcat |
Secondary structure (Cloverleaf model) | >PHG0100103 Glu TTC a GCCA atttctgcat G - C T - A C - G C - G T - A G - C T - A C T T C G C C C A C A A A | | | | | G T A C A G G C G G G C G | | | T T G A G T C T A A A GATTT C - G T - A A - T C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |