Sequence ID | >PHG0100375 |
Genome ID | CP000917 |
Search identical group | |
Phylum/Class | Siphoviridae |
Species | Escherichia virus EPS7 phi812b (CP000917) |
Start position on genome | 31168 |
End posion on genome | 31093 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gccaaatact |
tRNA gene sequence |
TGGAGAGTAGTGTAACGGTTAGCACAACGGCCTTTGACTCCGTTAATGGTAGGTTCGATT |
Downstream region at tRNA end position |
atttatgcgt |
Secondary structure (Cloverleaf model) | >PHG0100375 Gln TTG t GCCA atttatgcgt T - A G - C G - C A - T G - C A - T G + T T T T C C T C C A C A A A | | | | G G T G T G G T A G G C G + | | | T T T G C A C T A A TAATG A - T C - G G - C G - C C T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |