Sequence ID | >PHG14101982 |
Genome ID | JX875065 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Staphylococcus phage SA5 Pseudomonas putida GB-1 (JX875065) |
Start position on genome | 56903 |
End posion on genome | 56974 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gatatttcta |
tRNA gene sequence |
GGACTCTTAGCTTAAAGGTAAAGCCAACCGCTCATAACGGTTTGACTGTAGGTTCGAATC |
Downstream region at tRNA end position |
accaggctag |
Secondary structure (Cloverleaf model) | >PHG14101982 Met CAT a Atat accaggctag G - C G - C A - T C - G T - A C - G T - A T A T C G T C C A A A A | + | | | G A T T C G G T A G G C G | | | | T T G A A G C T A C TGACT A - T A - T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |