Sequence ID | >PHG14103323 |
Genome ID | KM657822 |
Search identical group | |
Phylum/Class | Myoviridae |
Species | Escherichia phage vB_EcoM-VpaE1 DSS3-P1 (KM657822) |
Start position on genome | 28969 |
End posion on genome | 29044 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
aaagatttaa |
tRNA gene sequence |
AGGGGATTAGTTTACAAGGTTAAAACCTCGGTCTTTGAAATCGAAGAAGTTGGTTCAATT |
Downstream region at tRNA end position |
atgctccatt |
Secondary structure (Cloverleaf model) | >PHG14103323 Gln TTG a GCCA atgctccatt A C G - C G - C G - C G - C A - T T - A T T T C A A C C A A C A A | | | | | A A T T T G G T T G G C G | | | | T T G A A A C T T A C AGAA T - A C - G G - C G + T T - A C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |