Sequence ID | >PL171000110 |
Genome ID | AP018191 |
Search identical group | |
Phylum/Class | Cyanobacteria |
Species | Nostoc sp. NIES-2111 plasmid:plasmid7 |
Start position on genome | 23128 |
End posion on genome | 23199 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cttgactaat |
tRNA gene sequence |
GCGATCGTGGTGTAACGGCAGCATCAGAGTCTTCCAAACTCACGGTACGAGTTCGAGTCT |
Downstream region at tRNA end position |
ttagccctgt |
Secondary structure (Cloverleaf model) | >PL171000110 Gly TCC t TCtc ttagccctgt G - C C - G G - C A - T T - A C - G G - C T G T T G C T C A A A G | | | | | G C T G T G A C G A G C G + | | + T T G G C A T C A C CGGT A A G - C A - T G - C T - A C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |