Sequence ID | >PL171000886 |
Genome ID | CP012860 |
Search identical group | |
Phylum/Class | Bacteroidetes |
Species | Persicobacter sp. JZB09 plasmid:JZB09-Plasmid2 |
Start position on genome | 733669 |
End posion on genome | 733746 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ctctccgcca |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTCATCGCGCCTGCTTTGGGAGCAGGAGGTCGCAGGTTCGA |
Downstream region at tRNA end position |
gtgccgcagc |
Secondary structure (Cloverleaf model) | >PL171000886 Pro TGG a ACAA gtgccgcagc C - G G - C G - C G - C G - C T - A G - C T A T C G T C C A C C G A A | | | | | G C T G C G G C A G G C G | | | T T G T C G C T C A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |