Sequence ID | >R05100371 |
Genome ID | AP008210 |
Search identical group | |
Phylum/Class | Plant |
Species | Oryza sativa Japonica Group |
Chromosome | chr04 |
Start position on genome | 9149778 |
End posion on genome | 9149702 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cactacgaagaaattccgggagttacgaaagaagcttcggactcatattgttcatgggttgagagcgggagttgaactctaggaggtcgaatcccccttT |
tRNA gene sequence |
TCCTCAGTAGCTCAGTGGTAGAGCGGTCGGCTGTTAACTGACTGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
Tgattcattctttaatgtaagaataaagaattgaattaaagggcttgctttgacccttaggagtaggtaacccgttcgctatccttgtttctattgcatt |
Secondary structure (Cloverleaf model) | >R05100371 Asn GTT T GATT Tgattcattctttaatgtaagaataaagaattgaattaaagggcttgctttgacccttaggagtaggtaacccgttcgctatccttgtttctattgcatt T - A C - G C - G T + G C - G A - T G + T T A T C A T C C A G A A | | | | | G T C T C G G T A G G C G | | | | T T G G A G C T A G TGGTC G - C T - A C - G G + T G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [RAP-DB] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |