Sequence ID | >W1710791998 |
Genome ID | LJOE01000007 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Aeromonas dhakensis hydrophila [LJOE] |
Start position on genome | 140300 |
End posion on genome | 140226 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
catctctagt |
tRNA gene sequence |
TGGGGTATCGCCAAGCGGTAAGGCAGCGGGTTTTGATCTCGCCATCCCTAGGTTCGAATC |
Downstream region at tRNA end position |
ttatttcagt |
Secondary structure (Cloverleaf model) | >W1710791998 Gln TTG t GCCA ttatttcagt T - A G - C G - C G - C G - C T - A A - T T A T G A T C C A G A C | | | | | G C A C C G C T A G G C G | | | T T G A G G C T A A CATCC G - C C - G G - C G + T G - C T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |