Sequence ID | >W1710797098 |
Genome ID | LJST01000076 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Halomonas sp. HL-93 [LJST] |
Start position on genome | 172 |
End posion on genome | 248 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
acgatacagc |
tRNA gene sequence |
GGACCGGTAGTTCAGTTGGTTAGAATGCCGGCCTGTCACGCCGGAGGTCGCGAGTTCGAG |
Downstream region at tRNA end position |
tcgtcgcttc |
Secondary structure (Cloverleaf model) | >W1710797098 Asp GTC c GCCA tcgtcgcttc G - C G - C A - T C - G C - G G - C G - C T G T T G C T C A T G A A + | | | | G T C T T G G C G A G C G | | | + T T G G A A T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |