Sequence ID | >W1710798411 |
Genome ID | LJTL01000004 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacterales bacterium SG8_35_2 [LJTL] |
Start position on genome | 32014 |
End posion on genome | 32090 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
atggacatat |
tRNA gene sequence |
GCGCCTGTAGCTCAGCTGGATAGAGCAACGGACTTCTAATCCGTAGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gtgatagaaa |
Secondary structure (Cloverleaf model) | >W1710798411 Arg TCT t GCCA gtgatagaaa G - C C - G G - C C - G C - G T - A G - C T A T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | | T T G G A G C A T A A AGGTC A - T C - G G - C G - C A - T C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |