| Sequence ID | >W1710799189 |
| Genome ID | LJUK01000117 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillales bacterium SM23_46 [LJUK] |
| Start position on genome | 1681 |
| End posion on genome | 1757 |
| Amino Acid | Arg |
| Anticodon | TCT |
| Upstream region at tRNA start position |
gcgcgagttt |
| tRNA gene sequence |
GCGCCCGTAGCTCAACCGGATAGAGCACCAGCCTTCTAAGCTGGCGGTTACAGGTTCGAG |
| Downstream region at tRNA end position |
gattgggggc |
| Secondary structure (Cloverleaf model) | >W1710799189 Arg TCT
t GCCA gattgggggc
G - C
C - G
G - C
C - G
C - G
C - G
G - C T G
T T G T C C A
C A A A | | | | | G
C C T C G A C A G G C
G | | | | T T
G G A G C
A T A A CGGTT
C - G
C - G
A - T
G - C
C - G
C A
T A
T C T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |