| Sequence ID | >W1710799776 |
| Genome ID | LJVB01000114 |
| Phylum/Class | Acidithiobacillia |
| Species | Acidithiobacillales bacterium SM1_46 [LJVB] |
| Start position on genome | 3515 |
| End posion on genome | 3591 |
| Amino Acid | Pro |
| Anticodon | CGG |
| Upstream region at tRNA start position |
tcgttccgtt |
| tRNA gene sequence |
CGGGGTGTAGCTCAGCCTGGTAGAGCACTTGCTTCGGGAGCAAGGGGCCGGAGGTTCAAA |
| Downstream region at tRNA end position |
acgtcgctgt |
| Secondary structure (Cloverleaf model) | >W1710799776 Pro CGG
t ACCA acgtcgctgt
C - G
G - C
G - C
G - C
G - C
T - A
G - C T A
T T C T C C A
C G A A + | | | | A
C C T C G G G A G G C
T | | | | T T
G G A G C
G T A A GGGCC
C - G
T - A
T - A
G - C
C - G
T A
T G
C G G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |