Sequence ID | >W1710802138 |
Genome ID | LJXR01000013 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Corynebacterium diphtheriae bv. gravis [LJXR] |
Start position on genome | 7512 |
End posion on genome | 7437 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taacaggctt |
tRNA gene sequence |
GCTCCCATCGTCTAGGGGCCTAGGACACCGCCCTTTCACGGCGGCGACACGGGTTCGAAT |
Downstream region at tRNA end position |
ccactttttc |
Secondary structure (Cloverleaf model) | >W1710802138 Glu TTC t ACCA ccactttttc G + T C - G T - A C - G C - G C - G A - T T A T T G C C C A G G A C | | | | | G G T C T G A C G G G C G + | | | T T C G G A C C T A A CGAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |