Sequence ID | >W1710802986 |
Genome ID | LJYF01000031 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium yuanmingense [LJYF] |
Start position on genome | 593140 |
End posion on genome | 593066 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccctgcgttt |
tRNA gene sequence |
GCTCCCTTCGTCTATCGGTTAGGACGCCACCCTTTCACGGTGGAGAGAGCGGTTCGATTC |
Downstream region at tRNA end position |
gcaaaatcaa |
Secondary structure (Cloverleaf model) | >W1710802986 Glu TTC t GCCA gcaaaatcaa G - C C - G T - A C - G C - G C - G T - A T T T T C G C C A C T A C | | | | | G G T C T G A G C G G C G + | | | T T T G G A C T A G AGAG C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |