Sequence ID | >W1710803024 |
Genome ID | LJYG01000097 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Bradyrhizobium manausense [LJYG] |
Start position on genome | 66569 |
End posion on genome | 66485 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gtatctccta |
tRNA gene sequence |
GCGCTCGTGGCGGAACTGGTAGACGCGCTGCCTTGAGGTGGCAGTGGGTAACACCGTGGG |
Downstream region at tRNA end position |
cccccacttt |
Secondary structure (Cloverleaf model) | >W1710803024 Leu GAG a ACCA cccccacttt G - C C - G G - C C - G T - A C - G G - C T G T C T C C C A C A A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T A G G TGGGTAACACCGT C - G T - A G - C C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |