Sequence ID | >W1710804702 |
Genome ID | LJZJ01000088 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa [LJZJ] |
Start position on genome | 114403 |
End posion on genome | 114478 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ccaagacgat |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
attcttcatc |
Secondary structure (Cloverleaf model) | >W1710804702 Gly GCC t TCCA attcttcatc G - C C - G G - C G - C G - C A - T A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |