Sequence ID | >W1710806600 |
Genome ID | LKBD01000003 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. P1-9 [LKBD] |
Start position on genome | 201076 |
End posion on genome | 201151 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ggaattgagc |
tRNA gene sequence |
GGGTCATTAGCTCAGTTGGTAGAGCAGTGGACTTTTAATCCATTGGTCGATGGTTCGAGT |
Downstream region at tRNA end position |
ttcgaaatgc |
Secondary structure (Cloverleaf model) | >W1710806600 Lys TTT c ACCA ttcgaaatgc G - C G - C G - C T - A C - G A - T T - A T G T C T A C C A T G A A | | | | | G T C T C G G A T G G C G | | | | T T G G A G C T A A TGGTC G + T T - A G - C G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |