| Sequence ID | >W1710807323 |
| Genome ID | LKCX01000024 |
| Phylum/Class | Betaproteobacteria |
| Species | Curvibacter sp. PAE-UM [LKCX] |
| Start position on genome | 74008 |
| End posion on genome | 73924 |
| Amino Acid | Leu |
| Anticodon | CAA |
| Upstream region at tRNA start position |
ccctctcctt |
| tRNA gene sequence |
GCCCGGGTGGTGAAATTGGTAGACGCAGGGGACTCAAAACCCCCCGCCGCAAGGCGTGCC |
| Downstream region at tRNA end position |
cctctttgga |
| Secondary structure (Cloverleaf model) | >W1710807323 Leu CAA
t ACCA cctctttgga
G - C
C - G
C - G
C - G
G - C
G - C
G - C T T
T C G G C C A
T A A G | | | | | G
T A G T G G C C G G C
G | + | T T
G A C G C
T A G A CGCCGCAAGGCGT
G - C
G - C
G - C
G - C
A C
C A
T A
C A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |