Sequence ID | >W1710808639 |
Genome ID | LKDV01000021 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudoalteromonas sp. P1-13-1a [LKDV] |
Start position on genome | 87 |
End posion on genome | -1 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
tctgcgtcac |
tRNA gene sequence |
GGAGAGATGGCAGAGTGGTCGAATGCACCGGTCTTGAAAACCGGCATAGGTTTGTAGCCT |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >W1710808639 Ser TGA c NNnn nnnnnnnnnn G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T G A G | | | | | A G G A C G T A G G G C G | | | T T T A T G C C G A A CATAGGTTTGTAGCCTATC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |