Sequence ID | >W1710819531 |
Genome ID | LKPX01000062 |
Search identical group | |
Phylum/Class | Thermodesulfobacteriota |
Species | Desulfobacteraceae bacterium RAAP-1 [LKPX] |
Start position on genome | 15642 |
End posion on genome | 15734 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
gtttgattct |
tRNA gene sequence |
GGAGAGATGTCCGAGCGGCTGAAGGAGCACGACTGGAAATCGTGTGCGCTGGCAAAACCG |
Downstream region at tRNA end position |
gattcatttc |
Secondary structure (Cloverleaf model) | >W1710819531 Ser GGA t GCCA gattcatttc G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A C G A G | | | | | A G G C C T G A G G G C G | | | T T C A G G A T G A G TGCGCTGGCAAAACCGGCGCC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |