Sequence ID | >W1710837590 |
Genome ID | LLLQ01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas aeruginosa [LLLQ] |
Start position on genome | 294249 |
End posion on genome | 294174 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
ggacgccatt |
tRNA gene sequence |
GCGGGAATAGCTCAGTTGGTAGAGCACGACCTTGCCAAGGTCGGGGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
aattctacaa |
Secondary structure (Cloverleaf model) | >W1710837590 Gly GCC t TCCA aattctacaa G - C C - G G - C G - C G - C A - T A - T T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC C - G G - C A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |