Sequence ID | >W1710863421 |
Genome ID | LMFC01000002 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Cellulomonas sp. Root485 [LMFC] |
Start position on genome | 364635 |
End posion on genome | 364708 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gcggggtcat |
tRNA gene sequence |
GCGCCCGTAGCTCAATGGATAGAGCATCTGACTACGGATCAGAAGGTTGGGGGTTCGAGT |
Downstream region at tRNA end position |
ggaacaacgg |
Secondary structure (Cloverleaf model) | >W1710863421 Arg ACG t ACac ggaacaacgg G - C C - G G - C C - G C - G C - G G - C T G T T T C C C A T A A A + + | | | G G C T C G G G G G G C G | | | | T T A G A G C T A A AGGTT T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |