Sequence ID | >W1710864078 |
Genome ID | LMFP01000003 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Pelomonas sp. Root1444 [LMFP] |
Start position on genome | 629159 |
End posion on genome | 629073 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
acccagaatc |
tRNA gene sequence |
GCGCGGGTGGCGAAATTGGTAGACGCACCAGGTTTAGGTCCTGACGCCTTCACAGGCGTG |
Downstream region at tRNA end position |
ccactgtcct |
Secondary structure (Cloverleaf model) | >W1710864078 Leu TAG c ACCA ccactgtcct G - C C - G G - C C - G G - C G - C G - C T G T C G G C C A T A A G | | | | | G T A G C G G C C G G C G | | | T T G A C G C T A G A CGCCTTCACAGGCGT C A C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |