Sequence ID | >W1710865334 |
Genome ID | LMGP01000007 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Acidovorax sp. Root568 [LMGP] |
Start position on genome | 38233 |
End posion on genome | 38308 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tcagaggtat |
tRNA gene sequence |
GCGGCTGTAGCTCAGTGGATAGAGTATTGGCCTCCGAAGCCAAGGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
acggtacatg |
Secondary structure (Cloverleaf model) | >W1710865334 Arg CCG t ACCA acggtacatg G - C C - G G - C G - C C - G T - A G - C C T T C G C C C A T G A A | + | | | G G C T C G G T G G G C G | | | + T T A G A G T T A A GGGTC T - A T - A G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |