Sequence ID | >W1710866876 |
Genome ID | LMHV01000022 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Rhizobium sp. Root708 [LMHV] |
Start position on genome | 18844 |
End posion on genome | 18769 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
taaagcgtaa |
tRNA gene sequence |
AGGGGTATAGCTCAGCTGGTAGAGCGGCGGTCTCCAAAACCGCAGGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
tttttccaaa |
Secondary structure (Cloverleaf model) | >W1710866876 Trp CCA a GCCA tttttccaaa A - T G - C G - C G - C G - C T + G A - T C G T C T C C C A C G A A | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A G AGGTC G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |