Sequence ID | >W1710868866 |
Genome ID | LMJK01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Microbacterium sp. Root280D1 [LMJK] |
Start position on genome | 787266 |
End posion on genome | 787182 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atcccagcgc |
tRNA gene sequence |
GCGGGAGTGGTGAAATTGGCAGACACGCAGGATTTAGGTTCCTGTGCCCTAGGGCGTGTG |
Downstream region at tRNA end position |
atctgtcgca |
Secondary structure (Cloverleaf model) | >W1710868866 Leu TAG c ACCG atctgtcgca G - C C - G G - C G - C G + T A - T G - C T G T C A C C C A T A A G | | | | | A T A G T G G T G G G C G | | | T T G A C A C C A G G TGCCCTAGGGCGT C - G A - T G - C G - C A - T T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |