Sequence ID | >W1710870473 |
Genome ID | LMKN01000008 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas sp. Leaf20 [LMKN] |
Start position on genome | 1016551 |
End posion on genome | 1016478 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
agcgcatcga |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTGACGTAGAGGACTGCAAATCCTCGCACCCGGGTTCGATTCC |
Downstream region at tRNA end position |
atctgtctaa |
Secondary structure (Cloverleaf model) | >W1710870473 Cys GCA a TCCA atctgtctaa G - C G - C C - G C - G C - G G - C A - T T T T G G C C C A G A G | | | | | G T G G C G C C G G G C G | | + T T G A C G T T G A GCAC G - C A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |