Sequence ID | >W1710870904 |
Genome ID | LMKW01000010 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas sp. Leaf230 [LMKW] |
Start position on genome | 242396 |
End posion on genome | 242323 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ccctcgctga |
tRNA gene sequence |
TGCCCCGTCGTCTAATGGTAAGACTGCGGTTTCTGATACCGCCTATTGAGGTTCGAATCC |
Downstream region at tRNA end position |
gcgcctcccg |
Secondary structure (Cloverleaf model) | >W1710870904 Gln CTG a TCCA gcgcctcccg T - A G - C C - G C - G C - G C - G G - C T A T A C T C C A A A C | | | | | G T T C T G T G A G G C G | | | | T T G A G A C T A T CTAT G - C C - G G - C G - C T - A T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |