Sequence ID | >W1710871235 |
Genome ID | LMLD01000011 |
Search identical group | |
Phylum/Class | Alphaproteobacteria |
Species | Sphingomonas sp. Leaf38 [LMLD] |
Start position on genome | 1005195 |
End posion on genome | 1005120 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
ccaaccgcgc |
tRNA gene sequence |
GGGGCCGTAGCTCAGATGGGAGAGCGCTGCAATCGCACTGCAGAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
cgcgcaaatc |
Secondary structure (Cloverleaf model) | >W1710871235 Ala CGC c ACCA cgcgcaaatc G - C G - C G + T G - C C - G C - G G - C T T T T C C C C A A G A A | | | | | G T C T C G A G G G G C G | | | | T T G G A G C G A G AGGTC C - G T - A G - C C - G A - T A C T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |