Sequence ID | >W1710871681 |
Genome ID | LMLL01000011 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. Leaf58 [LMLL] |
Start position on genome | 82849 |
End posion on genome | 82927 |
Amino Acid | Arg |
Anticodon | TCG |
Upstream region at tRNA start position |
aacaaaaaac |
tRNA gene sequence |
CGAGGCGTAGCCAAACTGGATAACGCACCCCGCTTCGAACGGGAAGATTATAGGAGTTCG |
Downstream region at tRNA end position |
ctttcctctg |
Secondary structure (Cloverleaf model) | >W1710871681 Arg TCG c GCCA ctttcctctg C - G G - C A - T G - C G - C C - G G - C T A T T C C T C A C A A A | | | | | G T A C C G A G G A G C G | | T T G A C G C A T A A AGATTAT C A C - G C - G C - G G - C C A T A T C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |