Sequence ID | >W1710872520 |
Genome ID | LMMB01000001 |
Search identical group | |
Phylum/Class | Gammaproteobacteria |
Species | Pseudomonas sp. Leaf83 [LMMB] |
Start position on genome | 526498 |
End posion on genome | 526422 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aacttcctat |
tRNA gene sequence |
CGGGGTATAGCGCAGTCCGGTAGCGCGCTTGCTTTGGGAGCAAGATGTCGGGAGTTCGAA |
Downstream region at tRNA end position |
tttttgggtc |
Secondary structure (Cloverleaf model) | >W1710872520 Pro TGG t ACCA tttttgggtc C - G G - C G - C G - C G - C T - A A - T T A T C C C C C A T G A A | | | | G C C G C G G G G A G C C | | | | T T G G C G C G T A G ATGTC C - G T - A T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |