Sequence ID | >W1710873429 |
Genome ID | LMMT01000039 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Pseudorhodoferax sp. Leaf265 [LMMT] |
Start position on genome | 463529 |
End posion on genome | 463616 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
aaggatttca |
tRNA gene sequence |
GGAGAGGTGGCAGAGTGGTCGAATGTACCTGACTCGAAATCAGGCGTACCGCAAGGTACC |
Downstream region at tRNA end position |
aaagcaaaaa |
Secondary structure (Cloverleaf model) | >W1710873429 Ser CGA a GCCA aaagcaaaaa G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G A C G G T G G G C G | | + T T T A T G T C G A A CGTACCGCAAGGTACC C - G C - G T - A G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |