Sequence ID | >W1710874884 |
Genome ID | LMNY01000003 |
Search identical group | |
Phylum/Class | Actinomycetota |
Species | Nocardioides sp. Leaf307 [LMNY] |
Start position on genome | 430125 |
End posion on genome | 430050 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cggtgatgtt |
tRNA gene sequence |
GCGGATGTAGCTCAGTTGGTAGAGCGCGACCTTCCCAAGGTCGATGTCGCGAGTTCGAGT |
Downstream region at tRNA end position |
cacaccggca |
Secondary structure (Cloverleaf model) | >W1710874884 Gly CCC t TCCA cacaccggca G - C C - G G - C G - C A - T T - A G - C T G T T G C T C A T G A A + | | | | G T C T C G G C G A G C G | | | | T T G G A G C T A G ATGTC C - G G - C A - T C - G C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |