Sequence ID | >W1710878075 |
Genome ID | LMQQ01000001 |
Search identical group | |
Phylum/Class | Betaproteobacteria |
Species | Methylophilus sp. Leaf414 [LMQQ] |
Start position on genome | 66659 |
End posion on genome | 66584 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gggttgttac |
tRNA gene sequence |
GGGTGCTTAGCTCAGTTGGTAGAGCGTCGCCCTTACAAGGCGAATGTCAGCGGTTCGACC |
Downstream region at tRNA end position |
gacaatttaa |
Secondary structure (Cloverleaf model) | >W1710878075 Val TAC c ACCA gacaatttaa G - C G - C G - C T - A G - C C - G T - A C C T T T G C C A T G A A | + | | | G T C T C G A G C G G C G | | | | T T G G A G C T A G ATGTC T - A C - G G - C C - G C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |