Sequence ID | >W1710879043 |
Genome ID | LMRK01000014 |
Search identical group | |
Phylum/Class | Bacillota |
Species | Bacillus sp. Leaf49 [LMRK] |
Start position on genome | 1727 |
End posion on genome | 1811 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
taatgatcaT |
tRNA gene sequence |
GCCGGTGTGGCGGAATTGGCAGACGCGCACGACTCAAAATCGTGTTCCTCACGGAGTGCC |
Downstream region at tRNA end position |
atatcatcgg |
Secondary structure (Cloverleaf model) | >W1710879043 Leu CAA T ATCt atatcatcgg G + T C - G C - G G - C G - C T - A G - C C C T C G G C C A T A A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C C A G G TTCCTCACGGAGT C - G A - T C - G G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |