Sequence ID | >W1710888827 |
Genome ID | LNAA01000001 |
Search identical group | |
Phylum/Class | Cyanobacteriota |
Species | Oscillatoriales cyanobacterium MTP1 [LNAA] |
Start position on genome | 240467 |
End posion on genome | 240391 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tttcacggct |
tRNA gene sequence |
GCATCCTTAGCTCAGTTGGATAGAGCGTTGGCCTCCGGAGCCAAAGGTCGCTGGTTCGAA |
Downstream region at tRNA end position |
ctttgctttt |
Secondary structure (Cloverleaf model) | >W1710888827 Arg CCG t ACCA ctttgctttt G - C C - G A - T T - A C - G C - G T - A T A T C G A C C A T G A A | | | | | G T C T C G G C T G G C G | | | | T T G G A G C A T A G AGGTC T - A T - A G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |